WormBase Tree Display for Variation: WBVar00146412
expand all nodes | collapse all nodes | view schema
WBVar00146412 | Evidence | Paper_evidence | WBPaper00045317 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | h81 | |||||||
Other_name | T05E8.3.1:c.984T>A | ||||||||
CE37043:p.Tyr328Ter | |||||||||
HGVSg | CHROMOSOME_I:g.5476575A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T05E8 | |||||
Flanking_sequences | AGGTACGACCAGCAACCAATACTACCTTGGCATTGTTGAA | TATGATTGGAATTTTTCTGCCTGAAAAAAGTTTATTTCCC | |||||||
Mapping_target | CHROMOSOME_I | ||||||||
Source_location | 200 | CHROMOSOME_I | 5476578 | 5476578 | |||||
Type_of_mutation | Substitution | A | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023679 | ||||||||
Laboratory | KR | ||||||||
Analysis | WGS_Rose | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00020263 | |||||||
Transcript | T05E8.3.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T05E8.3.1:c.984T>A | ||||||||
HGVSp | CE37043:p.Tyr328Ter | ||||||||
cDNA_position | 984 | ||||||||
CDS_position | 984 | ||||||||
Protein_position | 328 | ||||||||
Exon_number | 6/17 | ||||||||
Codon_change | taT/taA | ||||||||
Amino_acid_change | Y/* | ||||||||
Genetics | Interpolated_map_position | I | 0.0276299 | ||||||
Mapping_data | In_2_point | 2524 | |||||||
In_multi_point | 1008 | ||||||||
In_pos_neg_data | 2561 | ||||||||
2708 | |||||||||
4548 | |||||||||
4549 | |||||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00040589 | |||||
WBPaper00000975 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003985 | |||||||
WBPaper00002829 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sterile adult mutants had a normal life-span of two to three weeks and grew to the expected size for Unc-13 adults (0.6+/-0.8 mm) | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000774 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These mutants arrested as adults and formed gonads, but had defects in germ cell proliferation, or in the formation of mature gametes. Mutants failed to undergo either spermatogenesis or oogenesis. The germ cells underwent proliferation, but not gamete differentiation. It is uncertain whether these germ cells remained in mitosis, or entered meiosis and failed to progress. There was no over proliferation of germ cells. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000670 | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | none of the sterile mutants were rescued by wild-type sperm, thereforenone of them had defects in spermatogenesis alone. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040589 | ||||||||
WBPaper00002829 | |||||||||
WBPaper00000975 | |||||||||
WBPaper00003985 | |||||||||
WBPaper00000699 | |||||||||
WBPaper00045317 | |||||||||
Method | Substitution_allele |