WormBase Tree Display for Variation: WBVar00146527
expand all nodes | collapse all nodes | view schema
WBVar00146527 | Evidence | Paper_evidence | WBPaper00002151 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | h294 | ||||||
Other_name | CE25437:p.Glu238Lys | |||||||
Y54E10BL.6.1:c.712G>A | ||||||||
HGVSg | CHROMOSOME_I:g.3007930C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10BL | ||||
Flanking_sequences | ttatcttttaaaaaattcaaatttcagccc | aacgactcacaggatcccactatacaattt | ||||||
Mapping_target | Y54E10BL | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002151 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023757 | |||||||
Laboratory | KR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003186 | ||||||
Transcript | Y54E10BL.6.1 (12) | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002151 | ||||
Genetics | Interpolated_map_position | I | -5.23812 | |||||
Mapping_data | In_2_point | 6029 | ||||||
In_pos_neg_data | 6215 | |||||||
6343 | ||||||||
6509 | ||||||||
6575 | ||||||||
6636 | ||||||||
Description | Phenotype | WBPhenotype:0000058 | Paper_evidence | WBPaper00003985 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003985 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to n2678 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to n2678 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
WBPaper00015066 | ||||||||
WBPaper00022141 | ||||||||
WBPaper00003985 | ||||||||
Method | Substitution_allele |