WormBase Tree Display for Variation: WBVar00239140
expand all nodes | collapse all nodes | view schema
| WBVar00239140 | Evidence | Paper_evidence | WBPaper00033467 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | pe1102 | |||||
| Other_name | ZC412.2.1:c.1499+95_2237delinsA | ||||||
| HGVSg | CHROMOSOME_V:g.14864725_14865704delinsT | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZC412 | |||
| Flanking_sequences | gggtgtaacagggttttaatagctaaataat | aataatctatcaagtgaagaagggaggtcat | |||||
| Mapping_target | ZC412 | ||||||
| Type_of_mutation | Insertion | a | |||||
| Deletion | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00022697 | ||||||
| Laboratory | JN | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001540 | |||||
| Transcript | ZC412.2.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | ZC412.2.1:c.1499+95_2237delinsA | ||||||
| cDNA_position | ?-2613 | ||||||
| CDS_position | ?-2237 | ||||||
| Protein_position | ?-746 | ||||||
| Intron_number | 9/15 | ||||||
| Exon_number | 10/16 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Genetics | Interpolated_map_position | V | 6.98102 | ||||
| Description | Phenotype | WBPhenotype:0000247 | Paper_evidence | WBPaper00033467 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays a significantly weaker response to ASEL-sensed Na+ and Li+ gradients | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001057 | Paper_evidence | WBPaper00033467 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays a significantly weaker response to ASEL-sensed Na+ and Li+ gradients | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0002171 | Paper_evidence | WBPaper00042397 | |||||
| Curator_confirmed | WBPerson1928 | ||||||
| Remark | gcy-14 mutant strain displays a significantly weaker response to ASEL-sensed alkaline pH | Paper_evidence | WBPaper00042397 | ||||
| Curator_confirmed | WBPerson1928 | ||||||
| Phenotype_not_observed | WBPhenotype:0000254 | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays normal responses to some salts | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001055 | Paper_evidence | WBPaper00033467 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays normal responses to some salts | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001056 | Paper_evidence | WBPaper00033467 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays normal responses to some salts | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001059 | Paper_evidence | WBPaper00033467 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | gcy-14 mutant strain displays normal responses to some salts | Paper_evidence | WBPaper00033467 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00033467 | ||||||
| WBPaper00042397 | |||||||
| Remark | pe1102 contains a 980 bp deletion and 1 bp (a) insertion, ranging from intron 8 to exon 9 of gcy-14. | ||||||
| Method | Deletion_and_insertion_allele |
