WormBase Tree Display for Variation: WBVar00239439
expand all nodes | collapse all nodes | view schema
WBVar00239439 | Evidence | Paper_evidence | WBPaper00029257 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | pk2298 | ||||||
Other_name | D2030.6.1:c.694C>T | |||||||
CE09083:p.Gln232Ter | ||||||||
HGVSg | CHROMOSOME_I:g.7587571G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | D2030 | ||||
Flanking_sequences | TTTCAGTTTCATAAGGAACTACGATCGTGC | AGAACAATCCACAACGCGTTCAAGAGAAAA | ||||||
Mapping_target | D2030 | |||||||
Type_of_mutation | Substitution | C | T | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029026 | |||||||
Laboratory | NL | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004178 | ||||||
Transcript | D2030.6.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.6.1:c.694C>T | |||||||
HGVSp | CE09083:p.Gln232Ter | |||||||
cDNA_position | 700 | |||||||
CDS_position | 694 | |||||||
Protein_position | 232 | |||||||
Exon_number | 4/11 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000521812 | |||||||
Genetics | Interpolated_map_position | I | 2.18446 | |||||
Description | Phenotype | WBPhenotype:0000394 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | PLG-1 was not detectable in Western blots of protein lysates. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had significantly reduced brood sizes at 20C and no or severely reduced brood sizes at 25C compared to wild-type animals. The temperature-sensitive period occurred during the adult stage. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000774 | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Sterility was only partially rescued by mating with wild-type males. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a significant reduction in the total number of germ nuclei at 20C and 25C. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 21U-RNAs were missing, as determined by Northern blot analysis. 21U-RNA depletion was observed at all temperatures examined. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15, 20, 25 | Paper_evidence | WBPaper00031961 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000743 | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a wild-type RNAi response to foreign dsRNA (data not shown). | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | miRNA expression was not altered. NOTE: Reads for mi-R78 and miR-798 were altered compared to wild-type; however, authors argue that these RNAs should be re-classified as 21U-RNAs, see Supplemental Materials. | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031961 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031961 | |||||||
WBPaper00029257 | ||||||||
Remark | well:5-g02, gene:D2030.6, position:1791, change:Q232X | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004178 Nonsense | ||||||||
Method | Substitution_allele |