WormBase Tree Display for Variation: WBVar00240990
expand all nodes | collapse all nodes | view schema
WBVar00240990 | Evidence | Paper_evidence | WBPaper00001453 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q35 | |||||||
Other_name | CE00237:p.Arg1174Ter | ||||||||
F02A9.6.1:c.3520C>T | |||||||||
HGVSg | CHROMOSOME_III:g.9098913C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK507 | |||||
Flanking_sequences | gcaaacgaacggcatcgtaatgatatcatg | gacagcaaatagtcaagtcaggtcatggtg | |||||||
Mapping_target | ZK507 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001453 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00047321 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001609 | |||||||
Transcript | F02A9.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F02A9.6.1:c.3520C>T | ||||||||
HGVSp | CE00237:p.Arg1174Ter | ||||||||
cDNA_position | 3592 | ||||||||
CDS_position | 3520 | ||||||||
Protein_position | 1174 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000521910 | ||||||||
WBInteraction000521914 | |||||||||
WBInteraction000521919 | |||||||||
WBInteraction000521922 | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000286 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Although signs of pharyngeal differentiation is seen within the embryo, morphogenesis is defective, and a recognizable worm is not made. | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Only 15-198 germ cells are produced in glp-1 mutants. All these germ cells differentiate into sperm | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00001007 | |||||||
WBPaper00001576 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 21/107 animals are Muv | Paper_evidence | WBPaper00001576 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
causes Muv, extra vulval differentiation, mimics lin-12(gf) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001576 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001007 | |||||||
WBPaper00001576 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001007 | ||||||
WBPaper00001576 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00001576 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00001576 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker phenotype than q46, some oocyte production, fertilized eggs arrest during embryogenesis) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00001007 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | fertilized eggs arrest during embryogenesis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000395 | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Oocytes and sperm are functional | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00014397 | ||||||||
WBPaper00014630 | |||||||||
WBPaper00001576 | |||||||||
WBPaper00001453 | |||||||||
WBPaper00001007 | |||||||||
WBPaper00020874 | |||||||||
Method | Substitution_allele |