WormBase Tree Display for Variation: WBVar00240995
expand all nodes | collapse all nodes | view schema
WBVar00240995 | Evidence | Paper_evidence | WBPaper00032144 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q71 | |||||||
Other_name | Y113G7B.5b.1:c.444G>A | ||||||||
CE23287:p.Trp148Ter | |||||||||
Y113G7B.5a.1:c.444G>A | |||||||||
CE39287:p.Trp148Ter | |||||||||
HGVSg | CHROMOSOME_V:g.20199915G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7B | |||||
Flanking_sequences | cacatgaagcttcaaagcaatttgtggaatg | attagagatattgctcaatcaggaattct | |||||||
Mapping_target | Y113G7B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032144 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (23) | |||||||||
Laboratory | JK | ||||||||
JH | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001482 | |||||||
Transcript | Y113G7B.5b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y113G7B.5b.1:c.444G>A | ||||||||
HGVSp | CE39287:p.Trp148Ter | ||||||||
cDNA_position | 476 | ||||||||
CDS_position | 444 | ||||||||
Protein_position | 148 | ||||||||
Exon_number | 4/6 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Y113G7B.5a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y113G7B.5a.1:c.444G>A | ||||||||
HGVSp | CE23287:p.Trp148Ter | ||||||||
cDNA_position | 484 | ||||||||
CDS_position | 444 | ||||||||
Protein_position | 148 | ||||||||
Exon_number | 4/7 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (29) | |||||||||
Genetics | Interpolated_map_position | V | 24.921 | ||||||
Mapping_data | In_2_point | 3388 | |||||||
3389 | |||||||||
In_multi_point | 1193 | ||||||||
1299 | |||||||||
1300 | |||||||||
1601 | |||||||||
2694 | |||||||||
Description | Phenotype | WBPhenotype:0000666 | Paper_evidence | WBPaper00031349 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animlas exhibit a compaction of oocytes in the gonad arm. | Paper_evidence | WBPaper00031349 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00031349 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031349 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000682 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX animals transformed into females; XO animals wildtype males. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001683 | Paper_evidence | WBPaper00001037 | |||||||
WBPaper00045521 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson22852 | |||||||||
Remark | There is no evidence of sperm, spermatogenesis, or germ cell death in fog-2 XX mutants. Further, oogenesis begins in fog-2 mutants at about the time spermatogenesis begins in wild type. Unlike XX animals, X0 animals homozygous for any of the fog-2 alleles are unaffected in either germline or soma. | Paper_evidence | WBPaper00001037 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001037 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001037 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001037 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002381 | Paper_evidence | WBPaper00046134 | |||||||
Curator_confirmed | WBPerson14245 | ||||||||
Remark | q71 homozygotes show precocious production of volatile sex pheromone | Paper_evidence | WBPaper00046134 | ||||||
Curator_confirmed | WBPerson14245 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CAV-1::GFP degradation had normal kinetics in unfertilized eggs. Authors report identical results with CAV-2::GFP. | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L4 hermaphrodites were incubated at 25C for 48 hr then examined under fluorescence. | Paper_evidence | WBPaper00027612 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | pwIs281 | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000394 | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PRG-1 was detectable in Western blots of protein lysates. | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00027612 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CAV-1 body formation normal in oocytes as assayed by CAV-1::GFP fluorescence. Authors report identical results with CAV-2::GFP. | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027612 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L4 hermaphrodites were incubated at 20C for 48 hr then examined under fluorescence. | Paper_evidence | WBPaper00027612 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | pwIs281 | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (23) | |||||||||
Method | Substitution_allele |