WormBase Tree Display for Variation: WBVar00240997
expand all nodes | collapse all nodes | view schema
WBVar00240997 | Name | Public_name | q75 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | H20J04.8.1:c.228_230+2del | ||||||||
HGVSg | CHROMOSOME_II:g.4324594_4324598del | ||||||||
Sequence_details | SMap | S_parent | Sequence | H20J04 | |||||
Flanking_sequences | gaatacgctgtatcttcataataatcgaat | gcgtagttttccgaaaaacgagcgaaaagt | |||||||
Mapping_target | H20J04 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022554 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003390 | |||||||
Transcript | H20J04.8.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | H20J04.8.1:c.228_230+2del | ||||||||
cDNA_position | 234-? | ||||||||
CDS_position | 228-? | ||||||||
Protein_position | 76-? | ||||||||
Intron_number | 2/3 | ||||||||
Exon_number | 2/4 | ||||||||
Interactor | WBInteraction000501294 | ||||||||
WBInteraction000501295 | |||||||||
WBInteraction000501296 | |||||||||
WBInteraction000501297 | |||||||||
WBInteraction000555214 | |||||||||
Genetics | Interpolated_map_position | II | -4.88183 | ||||||
Mapping_data | In_multi_point | 2790 | |||||||
In_pos_neg_data | 7380 | ||||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mog-2 alleles grew significantly slower than wild type siblings at 15 deg C and 20 deg C. Furthermore, mog-2(q75) larvae required more time to develop into adults than mog-2(ok1221). | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 20, 25 | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000052 (11) | |||||||||
WBPhenotype:0000385 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | XX mog mutant adults produce two to five times the normal number of sperm | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00001883 | |||||||
WBPaper00038354 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Germ cells that would normally become oocytes have been transformed into sperm instead | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
While mostly fertile at 15 deg C, more than 20% of mog-2 hermaphrodites developed as somatic females that made excess of sperm and no oocytes at 20 deg C. At 25 deg C, most germ lines are fully masculinized with only 1% of fertile progeny producing sperm and oocytes. | Paper_evidence | WBPaper00038354 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
ts Mog, at 25C hermaphrodite germline makes mostly sperm, rare abnormal oocytes. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | 81 percent | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
20, 25 | Paper_evidence | WBPaper00038354 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
25 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mostly fertile at 15 degrees. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001360 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001369 | Paper_evidence | WBPaper00038354 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | U2 snRNA was not coimmunoprecipitated in the absence of MOG-2 in a mog-2(ok1221) null mutant. | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001694 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In most mog-2-mog-6 homozygotes grown at 25C, spermatogenesis begins at the normal time and continues without switching to oogenesis | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000416 | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals produce refractile yolk droplets | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000508 | Paper_evidence | WBPaper00038354 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | While an alternatively spliced variant of the rpl-7A was detected in smg-1 and smg-1; mog-2 mutants, it was observed neither in wild type, nor in mog-2 animals. | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals grown at 25C have a normal vulva | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001883 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038354 | ||||||||
WBPaper00001883 | |||||||||
WBPaper00012610 | |||||||||
Method | Deletion_allele |