WormBase Tree Display for Variation: WBVar00241155
expand all nodes | collapse all nodes | view schema
WBVar00241155 | Name | Public_name | q544 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T23D8.9c.1:c.558G>A | ||||||||
T23D8.9b.1:c.*248G>A | |||||||||
CE18959:p.Val319= | |||||||||
T23D8.9a.1:c.957G>A | |||||||||
CE50477:p.Val186= | |||||||||
HGVSg | CHROMOSOME_I:g.9982363C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T23D8 | |||||
Flanking_sequences | tcctcacatgaaacactgcgcaaatcaggt | tttcaaattttcaactgtatcataatggga | |||||||
Mapping_target | T23D8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025233 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022575 | ||||||||
WBStrain00022587 | |||||||||
WBStrain00022589 | |||||||||
WBStrain00022636 | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006379 | |||||||
Transcript | T23D8.9b.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | T23D8.9b.1:c.*248G>A | ||||||||
cDNA_position | 968 | ||||||||
Exon_number | 7/11 | ||||||||
T23D8.9c.1 | VEP_consequence | synonymous_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | T23D8.9c.1:c.558G>A | ||||||||
HGVSp | CE50477:p.Val186= | ||||||||
cDNA_position | 558 | ||||||||
CDS_position | 558 | ||||||||
Protein_position | 186 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | gtG/gtA | ||||||||
Amino_acid_change | V | ||||||||
T23D8.9a.1 | VEP_consequence | synonymous_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | T23D8.9a.1:c.957G>A | ||||||||
HGVSp | CE18959:p.Val319= | ||||||||
cDNA_position | 965 | ||||||||
CDS_position | 957 | ||||||||
Protein_position | 319 | ||||||||
Exon_number | 7/12 | ||||||||
Codon_change | gtG/gtA | ||||||||
Amino_acid_change | V | ||||||||
Interactor (18) | |||||||||
Genetics | Interpolated_map_position | I | 4.13429 | ||||||
Mapping_data | In_multi_point | 5650 | |||||||
Description | Phenotype | WBPhenotype:0000095 | Paper_evidence | WBPaper00033137 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | There is an increase in the number of dorsal non-muscle coelomocytes (CCs) and ventral sex myoblasts derived from the M lineage in these animals. | Paper_evidence | WBPaper00033137 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | intrinsic CC::gfp; hlh-8::gfp | Paper_evidence | WBPaper00033137 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000318 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Vas deferens precursor cells undergo divisions with a lengthened cell cycle. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000822 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male gonads expressed multiple hermaphrodite-specific gonadal markers, in addition, some males contained gonadal cells that were characteristic in morphology of hermaphrodite gonadal cell types. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000893 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 7 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 19 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001357 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibited gonadal defects. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Vas deferens precursor cells undergo divisions that produce daughter cells with little of no size asymmetry, unlike in control animals where these divisions result in daughter cells that are radically different in size. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Analysis of AC formation gave an unexpected result. Whereas most sys-1 and pop-1 mutants made two or more ACs, as described previously (Miskowski et al. 2001; Siegfried and Kimble 2002), most sys-3, gon-15, gon-16, and many gon-14 mutants had only one AC, although a few had more (Table 6)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 96 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | syIs50 [cdh-3::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001968 | Paper_evidence | WBPaper00026603 | |||||||
WBPaper00035069 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Animals have no DTCs and can have extra AC cells. | Paper_evidence | WBPaper00026603 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00035069 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007854 | PATO:0000460 | Paper_evidence | WBPaper00026603 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00035069 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00035069 | |||||||
WBPaper00006440 | |||||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPerson2987 | |||||||||
Remark | "The sys-1, sys-3, gon-15, and gon-16 mutants had little effect on phasmid socket cells, but the gon-14(q686) temperature-sensitive mutant raised at restrictive temperature sometimes failed to take up dye into the phasmids (Table 5)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035069 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Low | 5 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007423 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00035069 | |||||
WBPaper00006440 | |||||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPerson2987 | |||||||||
Phenotype_not_observed | WBPhenotype:0001585 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast to the Wnt/MAPK mutants, which eliminate POP-1 asymmetry, sys-1, sys-3, gon-14, gon-15, and gon-16 mutants did not affect POP-1 asymmetry (Figure 5)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002136 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Analysis of AC formation gave an unexpected result. Whereas most sys-1 and pop-1 mutants made two or more ACs, as described previously (Miskowski et al. 2001; Siegfried and Kimble 2002), most sys-3, gon-15, gon-16, and many gon-14 mutants had only one AC, although a few had more (Table 6)." | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | syIs50 [cdh-3::GFP] | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00026603 | ||||||||
WBPaper00036019 | |||||||||
WBPaper00006440 | |||||||||
WBPaper00018421 | |||||||||
WBPaper00035069 | |||||||||
WBPaper00004521 | |||||||||
WBPaper00033137 | |||||||||
Method | Substitution_allele |