WormBase Tree Display for Variation: WBVar00241161
expand all nodes | collapse all nodes | view schema
WBVar00241161 | Evidence | Paper_evidence | WBPaper00005116 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | q624 | |||||
Other_name | CE46967:p.Asn225Ile | ||||||
W10C8.2.1:c.674A>T | |||||||
HGVSg | CHROMOSOME_I:g.2825050T>A | ||||||
Sequence_details | SMap | S_parent | Sequence | W10C8 | |||
Flanking_sequences | aaatcatgccacctctttccaagctcttta | tcaactctgcactctgtttctcattatttc | |||||
Mapping_target | W10C8 | ||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00022600 | ||||||
Laboratory | JK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004077 | |||||
Transcript | W10C8.2.1 (12) | ||||||
Interactor | WBInteraction000501870 | ||||||
WBInteraction000538573 | |||||||
WBInteraction000538589 | |||||||
WBInteraction000557519 | |||||||
Genetics | Interpolated_map_position | I | -5.39021 | ||||
Description | Phenotype (18) | ||||||
Reference | WBPaper00036019 | ||||||
WBPaper00027345 | |||||||
WBPaper00005832 | |||||||
WBPaper00005116 | |||||||
WBPaper00033102 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |