WormBase Tree Display for Variation: WBVar00241188
expand all nodes | collapse all nodes | view schema
| WBVar00241188 | Evidence | Paper_evidence | WBPaper00031914 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | q783 | |||||
| Other_name | R144.7b.1:c.250_944+66del | ||||||
| HGVSg | CHROMOSOME_III:g.5016231_5017401del | ||||||
| Sequence_details | SMap | S_parent | Sequence | R144 | |||
| Flanking_sequences | AAAGACCACGAGGTGAAGGAAAAGGAAAACGTCGTAATAACAGAAAAGGC | CTTCATTTATTCGAACGAGCCTCTCAACGCTTTTCACCCACTTTCCGTCG | |||||
| Mapping_target | R144 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00022637 | ||||||
| WBStrain00022648 | |||||||
| Laboratory | JK | ||||||
| Status | Live | Curator_confirmed | WBPerson4025 | ||||
| Affects | Gene | WBGene00020097 | |||||
| Transcript | R144.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1-2/10 | ||||||
| Exon_number | 1-2/11 | ||||||
| R144.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | R144.7b.1:c.250_944+66del | ||||||
| cDNA_position | 250-? | ||||||
| CDS_position | 250-? | ||||||
| Protein_position | 84-? | ||||||
| Intron_number | 1-4/14 | ||||||
| Exon_number | 1-4/15 | ||||||
| Interactor | WBInteraction000501190 | ||||||
| WBInteraction000503665 | |||||||
| Genetics | Interpolated_map_position | III | -2.2328 | ||||
| Description | Phenotype (14) | ||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00031914 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Homozygotes were viable. | Paper_evidence | WBPaper00031914 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031914 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000691 | Paper_evidence | WBPaper00031914 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Overall pattern of germ line development was similar to wild-type. | Paper_evidence | WBPaper00031914 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031914 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00031914 | ||||||
| WBPaper00061063 | |||||||
| Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267877 | ||||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||||
| Method | Deletion_allele |
