WormBase Tree Display for Variation: WBVar00241365
expand all nodes | collapse all nodes | view schema
WBVar00241365 | Name (3) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | K04F10 | ||||
Flanking_sequences | aaagtgatgacggtagacggaatcgattgt | atatcagtgtagttatggatcgatttctgt | ||||||
Mapping_target | K04F10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024972 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (21) | ||||||||
Laboratory | TR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003499 | ||||||
Transcript (4) | ||||||||
Genetics | Interpolated_map_position | I | 1.06202 | |||||
Description | Phenotype | WBPhenotype:0001175 | Paper_evidence | WBPaper00003711 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | 1.7% Him | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001208 | Paper_evidence | WBPaper00003711 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals showed strong resistance to RNAi. | Paper_evidence | WBPaper00003711 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001222 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutator, increased transposition of Tc1, Tc3, and Tc4, etc. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00035228 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | PGL-1 staining in the germline resembles wild type and appear associated with nuclei periphery. | Paper_evidence | WBPaper00035228 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (31) | ||||||||
Method | Substitution_allele |