WormBase Tree Display for Variation: WBVar00241454
expand all nodes | collapse all nodes | view schema
WBVar00241454 | Evidence | Paper_evidence | WBPaper00018906 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson453 | ||||
Name | Public_name | r1162 | |||
Other_name (16) | |||||
HGVSg | CHROMOSOME_V:g.6902386_6906045del | ||||
Sequence_details | SMap | S_parent | Sequence | K11C4 | |
Flanking_sequences | agctctccgaaagcgtcgatgatcaaacct | aaaaaaaaactataaaattcaagcaaatca | |||
Mapping_target | K11C4 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00030699 | ||||
WBStrain00030700 | |||||
WBStrain00034950 | |||||
WBStrain00040880 | |||||
WBStrain00040882 | |||||
WBStrain00056731 | |||||
Laboratory (2) | |||||
Status | Live | ||||
Affects | Gene | WBGene00006801 | |||
Transcript (16) | |||||
Interactor | WBInteraction000519345 | ||||
Isolation | Mutagen | Tc1 | |||
Genetics | Interpolated_map_position | V | 0.459264 | ||
Description (2) | |||||
Reference | WBPaper00040284 | ||||
WBPaper00018906 | |||||
WBPaper00066013 | |||||
Remark | Variation information submitted by WBPerson453 on 2022-11-17_09:04:46 via the Allele submission form. Submitted data refers to the negative strand. | Curator_confirmed | WBPerson51134 | ||
Submitted comments: Mutation starts and ends in introns, the theoretical spliced mRNA has a frameshift and has a STOP codon after the protein sequenceFERQIKNVDAHGANELLLRHLSSKIRHRSRQDRLGAQ, 30 bp upstream: AAGgtacccacagacactgtagttttgtgtttgattcggttgcgttccacatctaatctattaaaattctcaaactctccaatagattgtgaataacccaacacccccttctaacccctaaaccaatttgcagAACGTTGACGCCCATGGCGCAAACGAACTGCTCTTACGTCACCTCTCATCGAAAATTCGACATCGATCCCGGCAAGATCGCCTCGGCGCACAGgtttcgagcccgcatattatctctatcaactgtcttttttcgcctgatttgcttgaattttatagttttttttt, 30 bp downstream: agGTTTGATCATCGACGCTTTCGGAGAGCTTCGTGATCAACAAGAATCTGCAACTGAGAAGCTCGAGTCATCATGTTTCATTTGCGACATCGGCAAAGAAACGTTTGATCGGATGCCTCGAGGCTTCGAAATTCACACCACCAAAGAGCACAACTTTGCCAATTACCTgtatgttaaatgcttttattcaactgttctaacttttcaaacttctagGTTCTTCTTACAACATCTGGTCAACAAAGACGAAACAGAGTACACTGGTCAAGAAACGTACGTACGTGAGAAGTACGATAATCG We obtained this strain from the CGC and sequenced the deletion. | Person_evidence | WBPerson453 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Deletion_allele |