WormBase Tree Display for Variation: WBVar00241498
expand all nodes | collapse all nodes | view schema
WBVar00241498 | Name | Public_name | re1 | ||||
---|---|---|---|---|---|---|---|
Other_name (4) | |||||||
HGVSg | CHROMOSOME_I:g.6902709C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C48B6 | |||
Flanking_sequences | aaagctaaagaaagattgaccgatgcgatg | agttactcaatttgagaatgtctgaggttc | |||||
Mapping_target | C48B6 | ||||||
Type_of_mutation | Substitution | g | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00008389 | ||||||
Laboratory | DV | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004879 | |||||
Transcript | C48B6.6b.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C48B6.6b.1:c.6283G>T | ||||||
HGVSp | CE53740:p.Glu2095Ter | ||||||
cDNA_position | 6283 | ||||||
CDS_position | 6283 | ||||||
Protein_position | 2095 | ||||||
Exon_number | 36/42 | ||||||
Codon_change | Gag/Tag | ||||||
Amino_acid_change | E/* | ||||||
C48B6.6a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | C48B6.6a.1:c.6277G>T | ||||||
HGVSp | CE30258:p.Glu2093Ter | ||||||
cDNA_position | 6305 | ||||||
CDS_position | 6277 | ||||||
Protein_position | 2093 | ||||||
Exon_number | 37/44 | ||||||
Codon_change | Gag/Tag | ||||||
Amino_acid_change | E/* | ||||||
Interactor | WBInteraction000525289 | ||||||
Genetics | Interpolated_map_position | I | 1.47211 | ||||
Description | Phenotype | WBPhenotype:0000697 | Person_evidence | WBPerson516 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Please see CGC note, D. Reiner found this Smg suppressor in the background of HE110 unc-97(su110). It partially suppresses the Unc and also confers a pVul phenotype. re1 was detected by WGS and confirmed with PCR. | Person_evidence | WBPerson516 | ||||
Curator_confirmed | WBPerson712 | ||||||
Method | Substitution_allele |