WormBase Tree Display for Variation: WBVar00241522
expand all nodes | collapse all nodes | view schema
WBVar00241522 | Evidence | Paper_evidence | WBPaper00004181 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh61 | |||||||
Other_name (17) | |||||||||
HGVSg | CHROMOSOME_X:g.10664843C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F11A1 | |||||
Flanking_sequences | aactctttcaagacaccaacaattaagggg | aaaacgtttccgtcaacgtggatgatatgt | |||||||
Mapping_target | F11A1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004181 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (11) | |||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00241523 | ||||||||
WBVar00241524 | |||||||||
WBVar00604100 | |||||||||
Affects | Gene | WBGene00000908 | |||||||
Transcript | F11A1.3b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3b.1:c.1675C>T | ||||||||
HGVSp | CE27585:p.Gln559Ter | ||||||||
cDNA_position | 1675 | ||||||||
CDS_position | 1675 | ||||||||
Protein_position | 559 | ||||||||
Exon_number | 12/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3e.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.2:c.1627C>T | ||||||||
HGVSp | CE54230:p.Gln543Ter | ||||||||
cDNA_position | 2055 | ||||||||
CDS_position | 1627 | ||||||||
Protein_position | 543 | ||||||||
Exon_number | 15/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.1:c.1627C>T | ||||||||
HGVSp | CE54230:p.Gln543Ter | ||||||||
cDNA_position | 1835 | ||||||||
CDS_position | 1627 | ||||||||
Protein_position | 543 | ||||||||
Exon_number | 16/20 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3c.1:c.394C>T | ||||||||
HGVSp | CE27586:p.Gln132Ter | ||||||||
cDNA_position | 394 | ||||||||
CDS_position | 394 | ||||||||
Protein_position | 132 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3e.4 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.4:c.1627C>T | ||||||||
HGVSp | CE54230:p.Gln543Ter | ||||||||
cDNA_position | 1788 | ||||||||
CDS_position | 1627 | ||||||||
Protein_position | 543 | ||||||||
Exon_number | 15/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3f.1:c.1702C>T | ||||||||
HGVSp | CE54221:p.Gln568Ter | ||||||||
cDNA_position | 1843 | ||||||||
CDS_position | 1702 | ||||||||
Protein_position | 568 | ||||||||
Exon_number | 15/18 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3a.1:c.1852C>T | ||||||||
HGVSp | CE27584:p.Gln618Ter | ||||||||
cDNA_position | 1852 | ||||||||
CDS_position | 1852 | ||||||||
Protein_position | 618 | ||||||||
Exon_number | 14/18 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3g.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3g.1:c.1804C>T | ||||||||
HGVSp | CE54229:p.Gln602Ter | ||||||||
cDNA_position | 1835 | ||||||||
CDS_position | 1804 | ||||||||
Protein_position | 602 | ||||||||
Exon_number | 16/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3e.3 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.3:c.1627C>T | ||||||||
HGVSp | CE54230:p.Gln543Ter | ||||||||
cDNA_position | 2013 | ||||||||
CDS_position | 1627 | ||||||||
Protein_position | 543 | ||||||||
Exon_number | 17/21 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F11A1.3d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3d.1:c.1750C>T | ||||||||
HGVSp | CE39240:p.Gln584Ter | ||||||||
cDNA_position | 1750 | ||||||||
CDS_position | 1750 | ||||||||
Protein_position | 584 | ||||||||
Exon_number | 13/16 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (25) | |||||||||
Genetics | Interpolated_map_position | X | 2.36911 | ||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00027611 | |||||
WBPaper00024451 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0040024 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000033 | Paper_evidence | WBPaper00027611 | |||||||
WBPaper00024451 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Animals exhibit strong heterochronic defects including reiteration of L2 seam cell divisions at the L3 stage and reiteration of the L3 gonadal migration program at the L4 stage. | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
daf-12(rh61) mutants fail to execute L3 seam cell divisions on schedule and instead inappropriately repeat earlier larval programs (Fig. 3B; Table 1). Seam cells repeat L2 programs of proliferative division at the L3 stage. | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 90 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0048505 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00035307 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In daf-12(rh61) mutant larvae the hbl-1 reporter fails to be down regulated in the L3 stage | Paper_evidence | WBPaper00035307 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0060378 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000280 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-12(rh61) mutants fail to execute adult cuticle programs on schedule and instead inappropriately repeat earlier larval programs (Fig. 3B,D; Table 1). L4 programs of stem cell division at the adult stage giving rise to gaps in adult alae, indicated by a break in the three lines. | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 20 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0048505 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0042335 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000301 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-12(rh61) mutants fail to execute gonadal cell migrations (Mig phenotype) on schedule and instead inappropriately repeat earlier larval programs (Fig. 3F; Table 1). | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035307 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | daf-12(rh61) mutant larvae display a dramatic reduction in several let-7-Fam miRNAs (12- to 30-fold reduction in miR-795, miR-48, miR-241, and let-7) | Paper_evidence | WBPaper00035307 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | When the LBD was deleted up to the DIN-1 binding region, but leaving the DIN-1 binding region intact, the rate of leaving was slower than in the presumptive null background. | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00035307 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | LIN-28::GFP transgene is downregulated normally during the second larval stage in daf-12 mutants | Paper_evidence | WBPaper00035307 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00024451 | ||||||||
WBPaper00035307 | |||||||||
WBPaper00027611 | |||||||||
WBPaper00032266 | |||||||||
WBPaper00025790 | |||||||||
WBPaper00017778 | |||||||||
WBPaper00011341 | |||||||||
Method | Substitution_allele |