WormBase Tree Display for Variation: WBVar00241555
expand all nodes | collapse all nodes | view schema
WBVar00241555 | Evidence | Paper_evidence | WBPaper00028396 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | rh147 | |||||
Other_name | CE02318:p.Trp335Ter | ||||||
T05C12.6c.1:c.897-62G>A | |||||||
T05C12.6a.1:c.1004G>A | |||||||
CE25100:p.Trp335Ter | |||||||
T05C12.6b.1:c.1004G>A | |||||||
HGVSg | CHROMOSOME_II:g.8183750C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | T05C12 | |||
Flanking_sequences | ctgaaacgatgcccctcgacgttggagttt | ggtagaaaccgctgtgtaagggtacctcgc | |||||
Mapping_target | T05C12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028396 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034589 | ||||||
Laboratory | NJ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003241 | |||||
Transcript | T05C12.6b.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | T05C12.6b.1:c.1004G>A | ||||||
HGVSp | CE25100:p.Trp335Ter | ||||||
cDNA_position | 1017 | ||||||
CDS_position | 1004 | ||||||
Protein_position | 335 | ||||||
Exon_number | 7/11 | ||||||
Codon_change | tGg/tAg | ||||||
Amino_acid_change | W/* | ||||||
T05C12.6a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | T05C12.6a.1:c.1004G>A | ||||||
HGVSp | CE02318:p.Trp335Ter | ||||||
cDNA_position | 1019 | ||||||
CDS_position | 1004 | ||||||
Protein_position | 335 | ||||||
Exon_number | 7/11 | ||||||
Codon_change | tGg/tAg | ||||||
Amino_acid_change | W/* | ||||||
T05C12.6c.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | T05C12.6c.1:c.897-62G>A | ||||||
Intron_number | 6/9 | ||||||
Genetics | Interpolated_map_position | II | 0.749083 | ||||
Mapping_data | In_multi_point | 3292 | |||||
Description | Phenotype (14) | ||||||
Reference | WBPaper00015169 | ||||||
WBPaper00021801 | |||||||
WBPaper00014322 | |||||||
WBPaper00028396 | |||||||
WBPaper00011195 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003241 Amber_UAG W(335) to stop | Paper_evidence | WBPaper00028396 | ||||
Method | Substitution_allele |