WormBase Tree Display for Variation: WBVar00241694
expand all nodes | collapse all nodes | view schema
WBVar00241694 | Evidence | Person_evidence | WBPerson6467 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | s69 | ||||||
Other_name (22) | ||||||||
HGVSg | CHROMOSOME_I:g.7447391_7447395del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK524 | ||||
Flanking_sequences | TTTCGCATGCCTATGTACTAGATACATGTG | GAGTACCTGCAGTCTTGTCAACACTTTTG | ||||||
Mapping_target | ZK524 | |||||||
Type_of_mutation | Deletion | cgcag | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000475 | |||||||
WBStrain00007104 | ||||||||
WBStrain00054636 | ||||||||
Laboratory | BC | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006752 | ||||||
Transcript (11) | ||||||||
Interactor | WBInteraction000503381 | |||||||
WBInteraction000504822 | ||||||||
WBInteraction000504975 | ||||||||
Genetics | Interpolated_map_position | I | 2.08413 | |||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000157 | Paper_evidence | WBPaper00031426 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit a normal number of posterior body contractions/cycle (46/49). | Paper_evidence | WBPaper00031426 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | The presence or absence of each muscle contraction was scored for 11 defecation cycles in day 1 adults (n 6). | Paper_evidence | WBPaper00031426 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000867 | Person_evidence | WBPerson6467 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001513 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As assayed by regulated release of ANF::GFP from cultured neurons in depolarizing, Ba++ containing, buffer | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | tgIs5[Paex-3:ANF::GFP]unc-13(s69) | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00027304 | |||||||
WBPaper00031426 | ||||||||
WBPaper00032087 | ||||||||
WBPaper00030754 | ||||||||
WBPaper00026383 | ||||||||
WBPaper00018051 | ||||||||
WBPaper00064979 | ||||||||
WBPaper00065262 | ||||||||
Method | Deletion_allele |