WormBase Tree Display for Variation: WBVar00242457
expand all nodes | collapse all nodes | view schema
| WBVar00242457 | Evidence | Paper_evidence | WBPaper00005092 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sa9 | |||||||
| Other_name | D2030.10a.1:c.590_591delinsAA | ||||||||
| CE30741:p.Trp197Ter | |||||||||
| D2030.10b.1:c.590_591delinsAA | |||||||||
| CE30740:p.Trp197Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.7603673_7603674delinsAA | ||||||||
| Sequence_details | SMap | S_parent | Sequence | D2030 | |||||
| Flanking_sequences | ttttggaaatgacaagaagttttcatgaat | caagctcagataagcgaggtttgtttaaat | |||||||
| Mapping_target | D2030 | ||||||||
| Type_of_mutation | Substitution | gg | rr | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00022772 | ||||||||
| Laboratory | JT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000084 | |||||||
| Transcript | D2030.10b.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | D2030.10b.1:c.590_591delinsAA | ||||||||
| HGVSp | CE30741:p.Trp197Ter | ||||||||
| cDNA_position | 590-591 | ||||||||
| CDS_position | 590-591 | ||||||||
| Protein_position | 197 | ||||||||
| Exon_number | 5/20 | ||||||||
| Codon_change | tGG/tAA | ||||||||
| Amino_acid_change | W/* | ||||||||
| D2030.10a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | D2030.10a.1:c.590_591delinsAA | ||||||||
| HGVSp | CE30740:p.Trp197Ter | ||||||||
| cDNA_position | 607-608 | ||||||||
| CDS_position | 590-591 | ||||||||
| Protein_position | 197 | ||||||||
| Exon_number | 6/21 | ||||||||
| Codon_change | tGG/tAA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000557470 | ||||||||
| WBInteraction000557471 | |||||||||
| WBInteraction000557472 | |||||||||
| WBInteraction000557474 | |||||||||
| WBInteraction000557475 | |||||||||
| Genetics | Interpolated_map_position | I | 2.20484 | ||||||
| Mapping_data | In_2_point | 4228 | |||||||
| In_multi_point | 1480 | ||||||||
| 1481 | |||||||||
| 1693 | |||||||||
| 1694 | |||||||||
| In_pos_neg_data | 4750 | ||||||||
| 4751 | |||||||||
| 4764 | |||||||||
| 4765 | |||||||||
| 5959 | |||||||||
| 5960 | |||||||||
| Description | Phenotype | WBPhenotype:0000650 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | defecation defective | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000651 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | severely constipated; adult males not constipated and mate well. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001793 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | anterior body contraction (aBoc) and expulsion muscle contraction (Exp) steps of defecation nearly always missing | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00005092 | ||||||||
| Method | Substitution_allele |
