WormBase Tree Display for Variation: WBVar00249293

WBVar00249293 Name: Public_name: tm239
    Other_name: C33D12.1.1:c.87_437+105del
    HGVSg: CHROMOSOME_X:g.3069509_3070221del
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_X
    Flanking_sequences: taatgcactacaattaacacaaagtggcgt ccggaagaactctgagcagcaagttggttg
    Mapping_target: CHROMOSOME_X
    Source_location: 7 CHROMOSOME_X 3069508 3070222 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm239_external
      tm239_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 239
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000452
      WBGene00202458
    Transcript: C33D12.17 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: 236-?
        Exon_number: 1/1
      C33D12.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C33D12.1.1:c.87_437+105del
        cDNA_position: 202-?
        CDS_position: 87-?
        Protein_position: 29-?
        Intron_number: 2-3/4
        Exon_number: 2-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype (15)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000095 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. J.K.Lu: no defects in the M lineage Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KW
  Reference: WBPaper00032309
  Remark: 27769/27770-[F52E4]443/444 (713 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target C33D12 updated based on the VEP analysis pipeline to CHROMOSOME_X.
  Method: NBP_knockout_allele