WormBase Tree Display for Variation: WBVar00249297
expand all nodes | collapse all nodes | view schema
WBVar00249297 | Name | Public_name | tm243 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0464.5a.2:c.1817_1954-283del | |||||||
B0464.5d.1:c.665_802-283del | ||||||||
B0464.5c.1:c.953_1266+89del | ||||||||
B0464.5b.1:c.953_1090-283del | ||||||||
B0464.5a.1:c.1817_1954-283del | ||||||||
HGVSg | CHROMOSOME_III:g.9460087_9460783del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0464 | ||||
Flanking_sequences | cggatcatttggtgaaaatggctcaggaga | cttatttccactctgcaaccaaaattaccg | ||||||
Mapping_target | B0464 | |||||||
Source_location | 7 | CHROMOSOME_III | 9460086 | 9460784 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm243_external | |||||||
tm243_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 243 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004980 | ||||||
Transcript | B0464.5b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0464.5b.1:c.953_1090-283del | |||||||
cDNA_position | 981-? | |||||||
CDS_position | 953-? | |||||||
Protein_position | 318-? | |||||||
Intron_number | 7/12 | |||||||
Exon_number | 7/13 | |||||||
B0464.5a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0464.5a.1:c.1817_1954-283del | |||||||
cDNA_position | 2273-? | |||||||
CDS_position | 1817-? | |||||||
Protein_position | 606-? | |||||||
Intron_number | 6/10 | |||||||
Exon_number | 6/11 | |||||||
B0464.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0464.5c.1:c.953_1266+89del | |||||||
cDNA_position | 987-? | |||||||
CDS_position | 953-? | |||||||
Protein_position | 318-? | |||||||
Intron_number | 7-8/12 | |||||||
Exon_number | 7-8/13 | |||||||
B0464.5a.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0464.5a.2:c.1817_1954-283del | |||||||
cDNA_position | 1817-? | |||||||
CDS_position | 1817-? | |||||||
Protein_position | 606-? | |||||||
Intron_number | 5/10 | |||||||
Exon_number | 5/11 | |||||||
B0464.5d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0464.5d.1:c.665_802-283del | |||||||
cDNA_position | 665-? | |||||||
CDS_position | 665-? | |||||||
Protein_position | 222-? | |||||||
Intron_number | 4/7 | |||||||
Exon_number | 4/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as sterile by the National Bioresource Project of Japan. Mutation is balanced with eT1. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 3746/3747-4443/4444 (697 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |