WormBase Tree Display for Variation: WBVar00249310

WBVar00249310 Name: Public_name: tm258
    Other_name: K12H4.1.1:c.577+100_1019del
    HGVSg: CHROMOSOME_III:g.8068646_8069549del
  Sequence_details: SMap: S_parent: Sequence: K12H4
    Flanking_sequences: gtaagtcagtaagtttgttagctagttaac cttcaatgcatttaacgcattcaacgctct
    Mapping_target: K12H4
    Source_location: 7 CHROMOSOME_III 8068645 8069550 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm258_external
      tm258_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 258
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00197391
      WBGene00023107
      WBGene00000448
    Transcript: K12H4.t1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      K12H4.10 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      K12H4.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K12H4.1.1:c.577+100_1019del
        cDNA_position: ?-1068
        CDS_position: ?-1019
        Protein_position: ?-340
        Intron_number: 5-7/11
        Exon_number: 6-8/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000648 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: male mating behavior normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001408 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: pkd-2::gfp expression normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 26659/26660-27563/27564 (904 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele