WormBase Tree Display for Variation: WBVar00249311
expand all nodes | collapse all nodes | view schema
WBVar00249311 | Name | Public_name | tm259 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK1193.5c.2:c.373-110_699+7del | |||||||
ZK1193.5a.1:c.997-110_1323+7del | ||||||||
ZK1193.5d.3:c.373-110_690+7del | ||||||||
ZK1193.5c.1:c.373-110_699+7del | ||||||||
ZK1193.5e.1:c.997-110_1314+7del | ||||||||
ZK1193.5d.4:c.373-110_690+7del | ||||||||
ZK1193.5d.1:c.373-110_690+7del | ||||||||
ZK1193.5d.2:c.373-110_690+7del | ||||||||
ZK1193.5d.5:c.373-110_690+7del | ||||||||
HGVSg | CHROMOSOME_X:g.427814_428797del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1193 | ||||
Flanking_sequences | tcgataactagtaatcagtattaatataga | attcagattttcggccgtagtgttaggtct | ||||||
Mapping_target | ZK1193 | |||||||
Source_location | 7 | CHROMOSOME_X | 427813 | 428798 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm259_external | |||||||
tm259_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 259 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00022861 | ||||||
Transcript | ZK1193.5c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5c.2:c.373-110_699+7del | |||||||
Intron_number | 5-7/8 | |||||||
Exon_number | 6-7/9 | |||||||
ZK1193.5e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5e.1:c.997-110_1314+7del | |||||||
Intron_number | 6-8/8 | |||||||
Exon_number | 7-8/9 | |||||||
ZK1193.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5c.1:c.373-110_699+7del | |||||||
Intron_number | 6-8/9 | |||||||
Exon_number | 7-8/10 | |||||||
ZK1193.5d.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5d.4:c.373-110_690+7del | |||||||
Intron_number | 5-7/8 | |||||||
Exon_number | 6-7/9 | |||||||
ZK1193.5d.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5d.3:c.373-110_690+7del | |||||||
Intron_number | 6-8/9 | |||||||
Exon_number | 7-8/10 | |||||||
ZK1193.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5d.1:c.373-110_690+7del | |||||||
Intron_number | 7-9/10 | |||||||
Exon_number | 8-9/11 | |||||||
ZK1193.5d.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5d.2:c.373-110_690+7del | |||||||
Intron_number | 7-9/10 | |||||||
Exon_number | 8-9/11 | |||||||
ZK1193.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5a.1:c.997-110_1323+7del | |||||||
Intron_number | 7-9/10 | |||||||
Exon_number | 8-9/11 | |||||||
ZK1193.5d.5 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1193.5d.5:c.373-110_690+7del | |||||||
Intron_number | 4-6/7 | |||||||
Exon_number | 5-6/8 | |||||||
Interactor | WBInteraction000520533 | |||||||
WBInteraction000536221 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description (2) | ||||||||
Reference | WBPaper00031084 | |||||||
Remark | 21397/21398-22381/22382 (984 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |