WormBase Tree Display for Variation: WBVar00249337
expand all nodes | collapse all nodes | view schema
WBVar00249337 | Name | Public_name | tm288 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.6322687_6324682del | |||||||
Sequence_details | SMap | S_parent | Sequence | F26B1 | ||||
Flanking_sequences | tgtatccacgtggacgacgacggaatccgt | ttatcactcataccagaaaggtgctgaaga | ||||||
Mapping_target | F26B1 | |||||||
Source_location | 7 | CHROMOSOME_I | 6322686 | 6324683 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm288_external | |||||||
tm288_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 288 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002601 | ||||||
Transcript | F26B1.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-520 | |||||||
CDS_position | ?-484 | |||||||
Protein_position | ?-162 | |||||||
Intron_number | 2-4/8 | |||||||
Exon_number | 1-5/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00036106 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Homozygous mutants are embryonic lethal | Paper_evidence | WBPaper00036106 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000095 | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants displayed M lineage phenotypes | Paper_evidence | WBPaper00036106 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Animals have extra egl-15::gfp-positive sex muscles | Paper_evidence | WBPaper00036106 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00036106 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson2021 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
Some mutants survive to become sterile adults | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000852 | Paper_evidence | WBPaper00036106 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Animals lack functional embryonic and M-derived CCs | Paper_evidence | WBPaper00036106 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00036106 | |||||||
Remark | 14526/14527-16522/16523 (1996 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |