WormBase Tree Display for Variation: WBVar00249359
expand all nodes | collapse all nodes | view schema
WBVar00249359 | Name | Public_name | tm311 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R03E9.1.1:c.154+23_436-130del | |||||||
HGVSg | CHROMOSOME_X:g.6742662_6743129del | |||||||
Sequence_details | SMap | S_parent | Sequence | R03E9 | ||||
Flanking_sequences | ttcaaatggtaaagacatgacatttcgtaa | ttttccaattagtcccactactcccacaac | ||||||
Mapping_target | R03E9 | |||||||
Source_location | 7 | CHROMOSOME_X | 6742661 | 6743130 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm311_external | |||||||
tm311_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 311 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects (3) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. B. Conradt to the National Bioresource Project of Japan: slow growth at 15C (possibly lethal). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MD | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00061439 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. B. Conradt: slow growth at 15C (possibly lethal). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
MD | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00040863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mdl-1(tm311) mutants exhibited wild type levels of ftn-1 mRNA expression, as determined by qRT-PCR (Figure 2B) | Paper_evidence | WBPaper00040863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000520 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. L. Mathies to the National Bioresource Project of Japan: no obvious morphological defects. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | RA | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. J. Kaplan: non-Egl. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KP | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. L. Mathies to the National Bioresource Project of Japan: locomotion normal. Comment to the NBP from Dr. J. Kaplan: non-Unc. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | RA | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. L. Mathies to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | RA | |||||||
WBPhenotype:0001510 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. O. Hobert to the National Bioresource Project of Japan: ASE and AIY fate markers normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | OH | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00040863 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mdl-1(tm311) mutant animals displayed an induction of ftn-1 mRNA expression in response to 25 millimolar iron (ferric ammonium citrate) similar to that of wild type animals (Figure S1A). | Paper_evidence | WBPaper00040863 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003020 | Paper_evidence | WBPaper00040863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were treated with iron (25 millimolar ferric ammonium citrate, FAC) and ftn-1 transcript levels measured by qRT-PCR | Paper_evidence | WBPaper00040863 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (2) | ||||||||
Remark | 12683/12684-13151/13152 (468 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |