WormBase Tree Display for Variation: WBVar00249359

WBVar00249359 Name (3)
  Sequence_details: SMap: S_parent: Sequence: R03E9
    Flanking_sequences: ttcaaatggtaaagacatgacatttcgtaa ttttccaattagtcccactactcccacaac
    Mapping_target: R03E9
    Source_location: 7 CHROMOSOME_X 6742661 6743130 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm311_external
      tm311_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 311
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003163
    Transcript: R03E9.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R03E9.1.1:c.154+23_436-130del
        Intron_number: 2-3/4
        Exon_number: 3/5
    Interactor: WBInteraction000524630
      WBInteraction000524631
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. B. Conradt to the National Bioresource Project of Japan: slow growth at 15C (possibly lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MD
      WBPhenotype:0000039 Paper_evidence: WBPaper00061439
        Curator_confirmed: WBPerson49407
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. B. Conradt: slow growth at 15C (possibly lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              MD
      WBPhenotype:0000114 Paper_evidence: WBPaper00040863
        Curator_confirmed: WBPerson2987
        Remark: mdl-1(tm311) mutants exhibited wild type levels of ftn-1 mRNA expression, as determined by qRT-PCR (Figure 2B) Paper_evidence: WBPaper00040863
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: no obvious morphological defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. J. Kaplan: non-Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: locomotion normal. Comment to the NBP from Dr. J. Kaplan: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0001510 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: ASE and AIY fate markers normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OH
      WBPhenotype:0001838 Paper_evidence: WBPaper00040863
        Curator_confirmed: WBPerson2987
        Remark: mdl-1(tm311) mutant animals displayed an induction of ftn-1 mRNA expression in response to 25 millimolar iron (ferric ammonium citrate) similar to that of wild type animals (Figure S1A). Paper_evidence: WBPaper00040863
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003020 Paper_evidence: WBPaper00040863
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were treated with iron (25 millimolar ferric ammonium citrate, FAC) and ftn-1 transcript levels measured by qRT-PCR Paper_evidence: WBPaper00040863
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00040863
    WBPaper00061439
  Remark (2)
  Method: NBP_knockout_allele