WormBase Tree Display for Variation: WBVar00249359
expand all nodes | collapse all nodes | view schema
WBVar00249359 | Name | Public_name | tm311 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R03E9.1.1:c.154+23_436-130del | |||||||
HGVSg | CHROMOSOME_X:g.6742662_6743129del | |||||||
Sequence_details | SMap | S_parent | Sequence | R03E9 | ||||
Flanking_sequences | ttcaaatggtaaagacatgacatttcgtaa | ttttccaattagtcccactactcccacaac | ||||||
Mapping_target | R03E9 | |||||||
Source_location | 7 | CHROMOSOME_X | 6742661 | 6743130 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm311_external | |||||||
tm311_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 311 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003163 | ||||||
Transcript | R03E9.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R03E9.1.1:c.154+23_436-130del | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 3/5 | |||||||
Interactor | WBInteraction000524630 | |||||||
WBInteraction000524631 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. B. Conradt to the National Bioresource Project of Japan: slow growth at 15C (possibly lethal). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MD | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00061439 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
Phenotype_not_observed (8) | ||||||||
Reference | WBPaper00040863 | |||||||
WBPaper00061439 | ||||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |