WormBase Tree Display for Variation: WBVar00249364

WBVar00249364 Name: Public_name: tm316
    Other_name: CE19721:p.Arg551IlefsTer25
      C36C9.2.1:c.1652_1800del
    HGVSg: CHROMOSOME_X:g.1671686_1672196del
  Sequence_details: SMap: S_parent: Sequence: C36C9
    Flanking_sequences: caggtaaggaccgctgagctggatggagaa tttcaattgaaagatcacgtccagactgaa
    Mapping_target: C36C9
    Source_location: 7 CHROMOSOME_X 1671685 1672197 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm316_external
      tm316_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 316
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006550
    Transcript: C36C9.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson1562
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. R. Waterston to the National Bioresource Project of Japan: Dead eggs <10%. Originally classified as 'homozygous viable' by the NBP. Person_evidence: WBPerson1562
            Curator_confirmed: WBPerson712
  Remark: 4611/4612-5122/5123 (511 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele