WormBase Tree Display for Variation: WBVar00249373
expand all nodes | collapse all nodes | view schema
WBVar00249373 | Name | Public_name | tm325 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | ||||||||
Sequence_details | SMap | S_parent | Sequence | F30H5 | ||||
Flanking_sequences | tccgatttttctatttatttttctcaattt | aaacgctgtttaaatctgtgcaaatttggt | ||||||
Mapping_target | F30H5 | |||||||
Source_location | 7 | CHROMOSOME_III | 499640 | 500171 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TTTTTTTTTTNATTTTTNNCTTNGCCCGNAA | ||||||
Deletion | ||||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 325 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006781 | ||||||
Transcript | F30H5.1.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
Intron_number | 10/12 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 14441/14442- TTTTTTTTTTNATTTTTNNCTTNGCCCGNAA-14971/14972 (530 bp deletion + 31 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |