WormBase Tree Display for Variation: WBVar00249390

WBVar00249390 Name: Public_name: tm342
    Other_name: B0302.1b.1:c.106_459+15delinsTTATTCA
      B0302.1a.1:c.106_459+15delinsTTATTCA
    HGVSg: CHROMOSOME_X:g.17186493_17187313delinsTTATTCA
  Sequence_details: SMap: S_parent: Sequence: B0302
    Flanking_sequences: attagtcagtttgtcttcttattcaacgtc atgaactgaaaagaaagcccaatgtgaaat
    Mapping_target: B0302
    Source_location: 7 CHROMOSOME_X 17186492 17187314 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ttattca
      Deletion
    PCR_product: tm342_external
      tm342_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 342
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002207
    Transcript: B0302.1b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0302.1b.1:c.106_459+15delinsTTATTCA
        cDNA_position: 114-?
        CDS_position: 106-?
        Protein_position: 36-?
        Intron_number: 2-4/13
        Exon_number: 2-4/14
      B0302.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0302.1a.1:c.106_459+15delinsTTATTCA
        cDNA_position: 114-?
        CDS_position: 106-?
        Protein_position: 36-?
        Intron_number: 2-4/16
        Exon_number: 2-4/17
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002374 Paper_evidence: WBPaper00041467
        Curator_confirmed: WBPerson712
        Remark: All isolated sid-3 mutants appeared similar to sid-1 mutants in that silencing of the body wall muscle cell GFP expression was greatly reduced but, unlike sid-1-null mutants, was not eliminated. In addition, GFP expression in the pharynx was silenced to a greater extent in sid-3(-) animals than in wild-type animals. Taken together, our results suggest that sid-3 mutants are defective in the transport of silencing RNAs. Paper_evidence: WBPaper00041467
            Curator_confirmed: WBPerson712
  Reference: WBPaper00041467
  Remark: 18922/18923-ttattca-19743/19744 (821 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele