WormBase Tree Display for Variation: WBVar00249409
expand all nodes | collapse all nodes | view schema
WBVar00249409 | Name | Public_name | tm361 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C18A3.5a.1:c.241-136_476del | ||||||||
C18A3.5c.1:c.304_*228del | |||||||||
C18A3.5b.1:c.240+201_380del | |||||||||
HGVSg | CHROMOSOME_II:g.5713715_5714293del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C18A3 | |||||
Flanking_sequences | tcacggatcactttggcgtccgaaacatct | ctgtctcagtgtcggtgtggattggttgcc | |||||||
Mapping_target | C18A3 | ||||||||
Source_location | 7 | CHROMOSOME_II | 5713714 | 5714294 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm361_external | ||||||||
tm361_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 361 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015943 | |||||||
Transcript | C18A3.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C18A3.5a.1:c.241-136_476del | ||||||||
cDNA_position | ?-494 | ||||||||
CDS_position | ?-476 | ||||||||
Protein_position | ?-159 | ||||||||
Intron_number | 3-4/7 | ||||||||
Exon_number | 4-5/8 | ||||||||
C18A3.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C18A3.5c.1:c.304_*228del | ||||||||
cDNA_position | 322-558 | ||||||||
CDS_position | 304-? | ||||||||
Protein_position | 102-? | ||||||||
Intron_number | 4-6/8 | ||||||||
Exon_number | 4-7/9 | ||||||||
C18A3.5b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C18A3.5b.1:c.240+201_380del | ||||||||
cDNA_position | ?-398 | ||||||||
CDS_position | ?-380 | ||||||||
Protein_position | ?-127 | ||||||||
Intron_number | 3/5 | ||||||||
Exon_number | 4/6 | ||||||||
Interactor | WBInteraction000521770 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | II | |||||||
Description | Phenotype | WBPhenotype:0000182 | Paper_evidence | WBPaper00044006 | |||||
Curator_confirmed | WBPerson9883 | ||||||||
WBPhenotype:0000186 | Paper_evidence | WBPaper00044006 | |||||||
Curator_confirmed | WBPerson9883 | ||||||||
WBPhenotype:0000668 | Paper_evidence | WBPaper00044006 | |||||||
Curator_confirmed | WBPerson9883 | ||||||||
WBPhenotype:0000848 | Paper_evidence | WBPaper00045542 | |||||||
Curator_confirmed | WBPerson1724 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00045542 | |||||||
Curator_confirmed | WBPerson1724 | ||||||||
WBPhenotype:0001384 | Paper_evidence | WBPaper00044006 | |||||||
Curator_confirmed | WBPerson9883 | ||||||||
WBPhenotype:0001756 | Paper_evidence | WBPaper00044006 | |||||||
Curator_confirmed | WBPerson9883 | ||||||||
WBPhenotype:0001925 | Paper_evidence | WBPaper00044006 | |||||||
Curator_confirmed | WBPerson9883 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Zhang: normal locomotion. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Zhang: fertile | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. T. Schedl to the National Bioresource Project of Japan: no germline phenotype. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002259 | Paper_evidence | WBPaper00046432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants do not exhibit a reduction in PVD neuron terminal dendrites. | Paper_evidence | WBPaper00046432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00046432 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0044292 | PATO:0001997 | Paper_evidence | WBPaper00046432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00044006 | ||||||||
WBPaper00045542 | |||||||||
WBPaper00046432 | |||||||||
Remark | 12290/12291-12869/12870 (579 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |