WormBase Tree Display for Variation: WBVar00249417
expand all nodes | collapse all nodes | view schema
WBVar00249417 | Name | Public_name | tm369 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F48F7.1a.2:c.2017+15_2781del | ||||||||
F48F7.1a.3:c.2017+15_2781del | |||||||||
F48F7.1b.1:c.2080+15_2844del | |||||||||
F48F7.1a.1:c.2017+15_2781del | |||||||||
HGVSg | CHROMOSOME_X:g.13953623_13954427del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F48F7 | |||||
Flanking_sequences | aaaactccagtttatggtatgtaatttgtt | caaatgtgccatacctacgtcagatgcaca | |||||||
Mapping_target | F48F7 | ||||||||
Source_location | 7 | CHROMOSOME_X | 13953622 | 13954428 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm369_external | ||||||||
tm369_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 369 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000105 | |||||||
Transcript | F48F7.1b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F48F7.1b.1:c.2080+15_2844del | ||||||||
cDNA_position | ?-2844 | ||||||||
CDS_position | ?-2844 | ||||||||
Protein_position | ?-948 | ||||||||
Intron_number | 5/6 | ||||||||
Exon_number | 6/7 | ||||||||
F48F7.1a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F48F7.1a.2:c.2017+15_2781del | ||||||||
cDNA_position | ?-3223 | ||||||||
CDS_position | ?-2781 | ||||||||
Protein_position | ?-927 | ||||||||
Intron_number | 6/8 | ||||||||
Exon_number | 7/9 | ||||||||
F48F7.1a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F48F7.1a.1:c.2017+15_2781del | ||||||||
cDNA_position | ?-2810 | ||||||||
CDS_position | ?-2781 | ||||||||
Protein_position | ?-927 | ||||||||
Intron_number | 5/7 | ||||||||
Exon_number | 6/8 | ||||||||
F48F7.1a.3 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F48F7.1a.3:c.2017+15_2781del | ||||||||
cDNA_position | ?-4501 | ||||||||
CDS_position | ?-2781 | ||||||||
Protein_position | ?-927 | ||||||||
Intron_number | 5/7 | ||||||||
Exon_number | 6/8 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the NBP from Dr. R.H. Horvitz: some die; Dr. C. Mello, Cell 127, 747-457 (2006). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | MT | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. R.H. Horvitz to the National Bioresource Project of Japan: sluggish. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | MT | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Phenotype_not_observed | WBPhenotype:0000181 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no effect on DA, DB projection patterns. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | WM | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005278 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 2131/2132-2936/2937 (805 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |