WormBase Tree Display for Variation: WBVar00249432

WBVar00249432 Name: Public_name: tm384
    Other_name: C36H8.1.1:c.557_866-19del
    HGVSg: CHROMOSOME_IV:g.12743504_12743947del
  Sequence_details: SMap: S_parent: Sequence: C36H8
    Flanking_sequences: CAGGGCTAATAGCTGCAAAAATTATTATTA CTTGTGGTGGTGGTCTTGGCGGTGGTGGAG
    Mapping_target: C36H8
    Type_of_mutation: Deletion
    PCR_product: tm384_external
      tm384_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 384
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007987
    Transcript: C36H8.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C36H8.1.1:c.557_866-19del
        cDNA_position: 632-?
        CDS_position: 557-?
        Protein_position: 186-?
        Intron_number: 4/5
        Exon_number: 4/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 2932/2933-3376/3377 (444 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele