WormBase Tree Display for Variation: WBVar00249445

WBVar00249445 Name: Public_name: tm397
    HGVSg: CHROMOSOME_V:g.4754240_4755005del
  Sequence_details: SMap: S_parent: Sequence: C18G1
    Flanking_sequences: gtgccctcaagtttcgcgccatttcgcatt ggccgccactggagagaagaaggctacgacgaccgtcgccaagaaggccgcca
    Mapping_target: C18G1
    Source_location: 7 CHROMOSOME_V 4754239 4755006 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm397_external
      tm397_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 397
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001855
    Transcript: C18G1.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-507
        CDS_position: ?-467
        Protein_position: ?-156
        Intron_number: 2/3
        Exon_number: 1-3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11321/11322-12087/12088 (766 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele