WormBase Tree Display for Variation: WBVar00249464
expand all nodes | collapse all nodes | view schema
| WBVar00249464 | Name | Public_name | tm416 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | C07H4.2.1:c.1197-26_1654delinsAA | ||||||
| HGVSg | CHROMOSOME_II:g.9096113_9096596delinsTT | ||||||
| Sequence_details | SMap | S_parent | Sequence | C07H4 | |||
| Flanking_sequences | TCATTCTGGTAACTCCTCCGAGCACTGCAG | TCAATTATAGAGCGAAGAATCTAATAATAC | |||||
| Mapping_target | C07H4 | ||||||
| Type_of_mutation | Insertion | TT | |||||
| Deletion | |||||||
| PCR_product | tm416_external | ||||||
| tm416_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | FX | ||||||
| Author | Mitani S | ||||||
| DB_info | Database | National_Bioresource_Project | seq | 416 | |||
| NBP_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000532 | |||||
| Transcript | C07H4.2.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C07H4.2.1:c.1197-26_1654delinsAA | ||||||
| cDNA_position | ?-1662 | ||||||
| CDS_position | ?-1654 | ||||||
| Protein_position | ?-552 | ||||||
| Intron_number | 6/10 | ||||||
| Exon_number | 7/11 | ||||||
| Isolation | Mutagen | TMP/UV | |||||
| Genetics | Map | II | |||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0000540 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Comment from Dr. P. Roy to the National Bioresource Project of Japan: abnormal muscle arm development in heterozygote. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| Phenotype_not_observed | WBPhenotype:0000849 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. S. Shaham: no obvious defects in amphid function. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | 7024/7025-TT-7508/7509 (484 bp deletion +2 bp insertion) | ||||||
| This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 | Paper_evidence | WBPaper00041807 | |||||
| Method | NBP_knockout_allele |
