WormBase Tree Display for Variation: WBVar00249468

WBVar00249468 Name: Public_name: tm420
    Other_name: W06D12.3.1:c.54_551+226del
    HGVSg: CHROMOSOME_V:g.17725058_17725836del
  Sequence_details: SMap: S_parent: Sequence: W06D12
    Flanking_sequences: gattatatctaaacagttcctggcggcgga cctgagctcaagcctgagaataagcccaag
    Mapping_target: W06D12
    Source_location: 7 CHROMOSOME_V 17725057 17725837 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm420_external
      tm420_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004015
      WBStrain00004016
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 420
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001397
      WBGene00198082
    Transcript: W06D12.8 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: 7-?
        Exon_number: 1/1
      W06D12.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W06D12.3.1:c.54_551+226del
        cDNA_position: 55-?
        CDS_position: 54-?
        Protein_position: 18-?
        Intron_number: 2-3/4
        Exon_number: 2-3/5
    Interactor: WBInteraction000535445
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
    Mapping_data: In_multi_point: 4301
  Description: Phenotype: WBPhenotype:0000022 Paper_evidence: WBPaper00055256
        Curator_confirmed: WBPerson25685
          WBPerson712
        Remark: Animals containing mutations in any one of the three 9 FADs, fat-5, fat-6, and fat-7, display an increase in body length. fat-5 mutants display a significant increase from 48 hours onward. Paper_evidence: WBPaper00055256
            Curator_confirmed: WBPerson712
        Image: WBPicture0000014140 Paper_evidence: WBPaper00055256
            Curator_confirmed: WBPerson712
        Phenotype_assay: Control_strain: WBStrain00000001 Paper_evidence: WBPaper00055256
              Curator_confirmed: WBPerson25685
      WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: slow growth. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000138 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: mono-unsaturated fatty acids N17 are decreased. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000583 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: dumpish. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001418 Paper_evidence: WBPaper00044578
        Curator_confirmed: WBPerson12259
        Remark: Figure 4B Paper_evidence: WBPaper00044578
            Curator_confirmed: WBPerson12259
      WBPhenotype:0002360 Paper_evidence: WBPaper00040208
        Curator_confirmed: WBPerson10321
    Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT embryonic lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000054 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT larval lehtality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. K. Sakamoto: J. Biochem 144, 149 (2008); Dr. J. Watts and Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040208
    WBPaper00044578
    WBPaper00055256
    WBPaper00064979
  Remark: 19998/19999-20777/20778 (779 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele