WormBase Tree Display for Variation: WBVar00249491

WBVar00249491 Name: Public_name: tm445
    HGVSg: CHROMOSOME_V:g.9822280_9823799del
  Sequence_details: SMap: S_parent: Sequence: C50C10
    Flanking_sequences: gcgggaaattcaatgttttttcagaaaaaa aatagctccgtaacggtaaatgaaatgacc
    Mapping_target: C50C10
    Source_location: 7 CHROMOSOME_V 9822279 9823800 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm445_external
      tm445_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 445
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006070
    Transcript: C50C10.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 361-?
        CDS_position: 361-?
        Protein_position: 121-?
        Intron_number: 3-5/6
        Exon_number: 3-7/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
    Mapping_data: In_multi_point: 4708
  Description: Phenotype_not_observed: WBPhenotype:0000039 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. G. Jansen to the National Bioresource Project of Japan: WT aging. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000265 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. G. Jansen to the National Bioresource Project of Japan: WT chemotaxis to odorants. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 16797/16798-18317/18318 (1520 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele