WormBase Tree Display for Variation: WBVar00249531
expand all nodes | collapse all nodes | view schema
WBVar00249531 | Name | Public_name | tm488 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C33B4.3a.1:c.331-86_1608del | |||||||
C33B4.3c.1:c.331-86_1608del | ||||||||
C33B4.3b.1:c.331-86_1608del | ||||||||
HGVSg | CHROMOSOME_II:g.11388638_11390174del | |||||||
Sequence_details | SMap | S_parent | Sequence | C33B4 | ||||
Flanking_sequences | acctgttggcggtcgatgcacaatagttcc | tgcatctgatggaatatgacgcataaaaca | ||||||
Mapping_target | C33B4 | |||||||
Source_location | 7 | CHROMOSOME_II | 11388637 | 11390175 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm488_external | |||||||
tm488_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 488 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006444 | ||||||
Transcript | C33B4.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3b.1:c.331-86_1608del | |||||||
cDNA_position | ?-1789 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/11 | |||||||
Exon_number | 4-7/12 | |||||||
C33B4.3c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3c.1:c.331-86_1608del | |||||||
cDNA_position | ?-1688 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/13 | |||||||
Exon_number | 4-7/14 | |||||||
C33B4.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3a.1:c.331-86_1608del | |||||||
cDNA_position | ?-1686 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/12 | |||||||
Exon_number | 4-7/13 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000306 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Rongo to the National Bioresource Project of Japan: normal GLR-1::GFP expression. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | OR | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |