WormBase Tree Display for Variation: WBVar00249557
expand all nodes | collapse all nodes | view schema
WBVar00249557 | Name | Public_name | tm516 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F12F6.3a.1:c.729+59_834delinsCTCTTGGATCTTTCAGGTAACTGTGTCTATGT | ||||||||
HGVSg | CHROMOSOME_IV:g.11581430_11581915delinsCTCTTGGATCTTTCAGGTAACTGTGTCTATGT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F12F6 | |||||
Flanking_sequences | atagtgaatttacttttaaatgcccatact | cgtcttggatctttcaggtaactgtgtcta | |||||||
Mapping_target | F12F6 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 11581429 | 11581916 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | CTCTTGGATCTTTCAGGTAACTGTGTCTATGT | |||||||
Deletion | |||||||||
PCR_product | tm516_external | ||||||||
tm516_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 516 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004360 | |||||||
Transcript | F12F6.3a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F12F6.3a.1:c.729+59_834delinsCTCTTGGATCTTTCAGGTAACTGTGTCTATGT | ||||||||
cDNA_position | ?-844 | ||||||||
CDS_position | ?-834 | ||||||||
Protein_position | ?-278 | ||||||||
Intron_number | 7/11 | ||||||||
Exon_number | 8/12 | ||||||||
Interactor | WBInteraction000524821 | ||||||||
WBInteraction000524823 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos die at different stages of development; class I embryos arrest at the 1-1.25 fold stage (68.4, n=92), class II embryos elongate until the 1.5 fold stage (21.1%), then arrest, class III embryos continue development to the 2.5 fold stage then arrest (10.5%). Abnormalities were first observed during closure of the ventral cleft (80%, n=10). Oozing of cells was seen among embryos of all classes, although only a few cells oozing were seen in class III embryos. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00029050 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Homozygous progeny from homozygous hermaphrodites die before the L1 stage (99.3%, n=1622), or shortly after hatching (0.7%). Homozygous progeny from heterozygous hermaphrodites develop into adult worms 98.5% (n=404). | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000463 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Chondroitin levels are increased, heparan sulfate levels are decreased as measured by the amount of chondroitin and heparan sulfate GAG disaccharides, respectively, per mg of dried homogenate of worm. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some maternally rescued homozygous adults exhibited severe distortions in axon migration, especially with regards to the HSNs. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 26.5%, n=34 | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some maternally rescued homozygous adults accumulated dead embryos. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 53% (n=143) | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00029050 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some maternally rescued Egl adults exhibited vulval defects, ranging in severity in the degree of protrusion from the body 10um. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 62% of Egl animals (n=43) | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001478 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001566 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001681 | Paper_evidence | WBPaper00045926 | |||||||
Curator_confirmed | WBPerson105 | ||||||||
Phenotype_assay | Genotype | ojIs1 [pie-1::GFP::tbb-2 + unc-119(+)] | Paper_evidence | WBPaper00045926 | |||||
Curator_confirmed | WBPerson105 | ||||||||
Phenotype_not_observed | WBPhenotype:0000047 | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | E-daughter cell ingression and blastocoel formation occurred. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000611 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygote embryos exhibit twitching, active contractile movement (92.4%, n=92). | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00029050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of a pan-neuronal GFP reporter Ex[F25B3.3::gfp] and Ex[tph-1::DsRed] was observed in the expected cells, suggesting these neuronal cells have differentiated normally. | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00029050 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Ex[F25B3.3::gfp; dpy-20(+)] or Ex[tph-1::DsRed] | Paper_evidence | WBPaper00029050 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:206 | |||||||
Models_disease_in_annotation | WBDOannot00000003 | ||||||||
Reference | WBPaper00029050 | ||||||||
WBPaper00045926 | |||||||||
Remark | 37528/37529-CTCTTGGATCTTTCAGGTAACTGTGTCTATGT-38014/38015(486 bp deletion + 32 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |