WormBase Tree Display for Variation: WBVar00249564

WBVar00249564 Name: Public_name: tm524
    Other_name: CE05684:p.Asp192_Ter340delextTer?
      F22D6.3a.1:c.573_1019del
    HGVSg: CHROMOSOME_I:g.7088899_7089397del
  Sequence_details: SMap: S_parent: Sequence: F22D6
    Flanking_sequences: atgcgatccataagttgatcgaaagtgata ggagcggattttccatcgggaagtgccttg
    Mapping_target: F22D6
    Source_location: 7 CHROMOSOME_I 7088898 7089398 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm524_external
      tm524_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 524
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003815
    Transcript: F22D6.3a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 15540/15541-16039/16040 (499 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele