WormBase Tree Display for Variation: WBVar00249565

WBVar00249565 Name: Public_name: tm525
    Other_name: F25H2.5.2:c.55_421del
      CE09650:p.Gly19ThrfsTer23
      CE09650:p.Gly19ThrfsTer?
      F25H2.5.1:c.55_421del
    HGVSg: CHROMOSOME_I:g.10553235_10553659del
  Sequence_details: SMap: S_parent: Sequence: F25H2
    Flanking_sequences: cccatgagttgatgaatgggctggcgtagt actgaaatttaaaaaattaggattttgaaa
    Mapping_target: F25H2
    Source_location: 7 CHROMOSOME_I 10553234 10553660 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm525_external
      tm525_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 525
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009119
    Transcript: F25H2.5.1 (11)
      F25H2.5.2 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 19327/19328-19752/19753 (425bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele