WormBase Tree Display for Variation: WBVar00249586

WBVar00249586 Name: Public_name: tm547
    Other_name: F15C11.1.1:c.751+78_1162del
    HGVSg: CHROMOSOME_I:g.7045853_7046426del
  Sequence_details: SMap: S_parent: Sequence: F15C11
    Flanking_sequences: cttgcaattttaaaagcaatatggttctta tacatattcataatccgccaacatcagcag
    Mapping_target: F15C11
    Source_location: 7 CHROMOSOME_I 7045852 7046427 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm547_external
      tm547_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 547
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004773
    Transcript: F15C11.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F15C11.1.1:c.751+78_1162del
        cDNA_position: ?-1170
        CDS_position: ?-1162
        Protein_position: ?-388
        Intron_number: 6/11
        Exon_number: 7/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 22258/22259-22832/22833 (574 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele