WormBase Tree Display for Variation: WBVar00249622

WBVar00249622 Name: Public_name: tm586
    Other_name: W04D2.4.1:c.936_1273del
      CE06541:p.Glu313AsnfsTer4
    HGVSg: CHROMOSOME_V:g.12495961_12496343del
  Sequence_details: SMap: S_parent: Sequence: W04D2
    Flanking_sequences: ctgtacttgttttttgttcattggcaattt tgtattgcaatttcagttgttgtcggtttt
    Mapping_target: W04D2
    Source_location: 7 CHROMOSOME_V 12495960 12496344 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm586_external
      tm586_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 586
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012243
    Transcript: W04D2.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002541 Paper_evidence: WBPaper00024937
        Curator_confirmed: WBPerson8633
        Remark: Figure 3, reduced germ cell apoptosis upon ionizing radiation Paper_evidence: WBPaper00024937
            Curator_confirmed: WBPerson8633
    Phenotype_not_observed: WBPhenotype:0000741 Paper_evidence: WBPaper00024937
        Curator_confirmed: WBPerson8633
        Remark: Figure 3, normal mitotic cell cycle arrest upon ionizing radiation Paper_evidence: WBPaper00024937
            Curator_confirmed: WBPerson8633
      WBPhenotype:0000965 Paper_evidence: WBPaper00024937
        Curator_confirmed: WBPerson8633
        Remark: Table 2, no alternations in cell death in the pharynx Paper_evidence: WBPaper00024937
            Curator_confirmed: WBPerson8633
  Reference: WBPaper00024937
  Remark: 24198/24199-24581/24582 (385 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele