WormBase Tree Display for Variation: WBVar00249622
expand all nodes | collapse all nodes | view schema
WBVar00249622 | Name | Public_name | tm586 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W04D2.4.1:c.936_1273del | |||||||
CE06541:p.Glu313AsnfsTer4 | ||||||||
HGVSg | CHROMOSOME_V:g.12495961_12496343del | |||||||
Sequence_details | SMap | S_parent | Sequence | W04D2 | ||||
Flanking_sequences | ctgtacttgttttttgttcattggcaattt | tgtattgcaatttcagttgttgtcggtttt | ||||||
Mapping_target | W04D2 | |||||||
Source_location | 7 | CHROMOSOME_V | 12495960 | 12496344 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm586_external | |||||||
tm586_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 586 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00012243 | ||||||
Transcript | W04D2.4.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002541 | Paper_evidence | WBPaper00024937 | ||||||
Curator_confirmed | WBPerson8633 | |||||||
Remark | Figure 3, reduced germ cell apoptosis upon ionizing radiation | Paper_evidence | WBPaper00024937 | |||||
Curator_confirmed | WBPerson8633 | |||||||
Phenotype_not_observed | WBPhenotype:0000741 | Paper_evidence | WBPaper00024937 | |||||
Curator_confirmed | WBPerson8633 | |||||||
Remark | Figure 3, normal mitotic cell cycle arrest upon ionizing radiation | Paper_evidence | WBPaper00024937 | |||||
Curator_confirmed | WBPerson8633 | |||||||
WBPhenotype:0000965 | Paper_evidence | WBPaper00024937 | ||||||
Curator_confirmed | WBPerson8633 | |||||||
Remark | Table 2, no alternations in cell death in the pharynx | Paper_evidence | WBPaper00024937 | |||||
Curator_confirmed | WBPerson8633 | |||||||
Reference | WBPaper00024937 | |||||||
Remark | 24198/24199-24581/24582 (385 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |