WormBase Tree Display for Variation: WBVar00249625

WBVar00249625 Name: Public_name: tm589
    Other_name: C47C12.3a.1:c.188_364-20del
      C47C12.3b.1:c.227_403-20del
    HGVSg: CHROMOSOME_X:g.7746173_7746855del
  Sequence_details: SMap: S_parent: Sequence: C47C12
    Flanking_sequences: gccaatcatcttatttcagtaccctcggca cgatatgcttttcttgcaggccaagtacaa
    Mapping_target: C47C12
    Source_location: 7 CHROMOSOME_X 7746172 7746856 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm589_external
      tm589_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 589
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004335
    Transcript: C47C12.3b.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C47C12.3b.1:c.227_403-20del
        cDNA_position: 227-?
        CDS_position: 227-?
        Protein_position: 76-?
        Intron_number: 4/7
        Exon_number: 4/8
      C47C12.3a.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C47C12.3a.1:c.188_364-20del
        cDNA_position: 196-?
        CDS_position: 188-?
        Protein_position: 63-?
        Intron_number: 4/8
        Exon_number: 4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 2645/2646-3328/3329 (683 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele