WormBase Tree Display for Variation: WBVar00249628

WBVar00249628 Evidence: Paper_evidence: WBPaper00038390
  Name: Public_name: tm593
    Other_name: F47H4.1a.1:c.67+167_171del
    HGVSg: CHROMOSOME_V:g.17349468_17349828del
  Sequence_details: SMap: S_parent: Sequence: F47H4
    Flanking_sequences: GATAGTCTCTTTTTGGTTAAGAGCCCGCTC TTTGAGAACTTTTTCAAGCTTTTTAACAAA
    Mapping_target: F47H4
    Type_of_mutation: Deletion
    PCR_product: tm593_external
      tm593_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 593
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009834
    Transcript: F47H4.1a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F47H4.1a.1:c.67+167_171del
        cDNA_position: ?-303
        CDS_position: ?-171
        Protein_position: ?-57
        Intron_number: 2/4
        Exon_number: 3/5
      F47H4.1b.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-33
        CDS_position: ?-33
        Protein_position: ?-11
        Exon_number: 1/2
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0001512 Paper_evidence: WBPaper00038390
        Curator_confirmed: WBPerson712
        Remark: Class IV Lsy: ASER fate markers are gained in ASEL but ASEL fate markers are unaffected. | ot108 mutant animals show derepression of the ASER marker gcy-5 in ASEL, while gcy-7 expression in ASEL is unaffected. | The lsy phenotype of this mutant is milder than ot108 in terms of both expressivity and penetrance Paper_evidence: WBPaper00038390
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. R. Waterston to the National Bioresource Project of Japan: Dead eggs = 1/180. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Paper_evidence: WBPaper00038390
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
          WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
          Mutants are viable. Paper_evidence: WBPaper00038390
            Curator_confirmed: WBPerson712
      WBPhenotype:0000520 Paper_evidence: WBPaper00038390
        Curator_confirmed: WBPerson712
        Remark: Mutants display no morphological abnormalities. Paper_evidence: WBPaper00038390
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00038390
        Curator_confirmed: WBPerson712
        Remark: Mutants are fertile. Paper_evidence: WBPaper00038390
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038390
  Remark: 18452/18453-18813/18814 (361 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele