WormBase Tree Display for Variation: WBVar00249666
expand all nodes | collapse all nodes | view schema
WBVar00249666 | Name | Public_name | tm633 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK867.1b.3:c.-694+19_-48+112del | |||||||
ZK867.1b.1:c.-636+19_-48+112del | ||||||||
ZK867.1b.4:c.-636+19_-48+112del | ||||||||
ZK867.1d.1:c.316+19_904+112del | ||||||||
ZK867.1e.1:c.265+19_853+112del | ||||||||
ZK867.1f.1:c.316+19_904+112del | ||||||||
ZK867.1c.1:c.265+19_853+112del | ||||||||
ZK867.1b.2:c.-636+19_-48+112del | ||||||||
HGVSg | CHROMOSOME_X:g.7221118_7221903del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK867 | ||||
Flanking_sequences | gtaggttaaaaggttagtttttgattagat | aatcttatctttgaaactagaactgtcaaa | ||||||
Mapping_target | ZK867 | |||||||
Source_location | 7 | CHROMOSOME_X | 7221117 | 7221904 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm633_external | |||||||
tm633_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 633 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00044068 | ||||||
Transcript | ZK867.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1d.1:c.316+19_904+112del | |||||||
Intron_number | 3-5/8 | |||||||
Exon_number | 4-5/9 | |||||||
ZK867.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.1:c.-636+19_-48+112del | |||||||
Intron_number | 2-4/9 | |||||||
Exon_number | 3-4/10 | |||||||
ZK867.1b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.3:c.-694+19_-48+112del | |||||||
Intron_number | 3-4/9 | |||||||
Exon_number | 4/10 | |||||||
ZK867.1b.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.4:c.-636+19_-48+112del | |||||||
Intron_number | 2-4/9 | |||||||
Exon_number | 3-4/10 | |||||||
ZK867.1f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1f.1:c.316+19_904+112del | |||||||
Intron_number | 4-6/10 | |||||||
Exon_number | 5-6/11 | |||||||
ZK867.1b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.2:c.-636+19_-48+112del | |||||||
Intron_number | 3-5/10 | |||||||
Exon_number | 4-5/11 | |||||||
ZK867.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1c.1:c.265+19_853+112del | |||||||
Intron_number | 3-5/9 | |||||||
Exon_number | 4-5/10 | |||||||
ZK867.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1e.1:c.265+19_853+112del | |||||||
Intron_number | 2-4/7 | |||||||
Exon_number | 3-4/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as 'homozygous viable' by the NBP. Comments to the National Bioresource Project of Japan: Dr. M. Zhen: sterile or lethal but deletion that is not associated with the syd-9 gene. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as 'homozygous viable' by the NBP. Comments to the National Bioresource Project of Japan: Dr. M. Zhen: sterile or lethal but deletion that is not associated with the syd-9 gene. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000743 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 15848/15849-16634/16635 (786 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |