WormBase Tree Display for Variation: WBVar00249700
expand all nodes | collapse all nodes | view schema
WBVar00249700 | Name | Public_name | tm668 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H15N14.1e.1:c.211_690+13del | |||||||
H15N14.1d.1:c.211_690+13del | ||||||||
H15N14.1c.1:c.211_897+13del | ||||||||
HGVSg | CHROMOSOME_I:g.7774199_7775165del | |||||||
Sequence_details | SMap | S_parent | Sequence | H15N14 | ||||
Flanking_sequences | caacaacaggctcaacaacaagctcagaat | tttcaaaagctgtacttataaattctcaag | ||||||
Mapping_target | H15N14 | |||||||
Source_location | 7 | CHROMOSOME_I | 7774198 | 7775166 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm668_external | |||||||
tm668_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000437 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 668 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000079 | ||||||
Transcript | H15N14.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H15N14.1d.1:c.211_690+13del | |||||||
cDNA_position | 233-? | |||||||
CDS_position | 211-? | |||||||
Protein_position | 71-? | |||||||
Intron_number | 4-7/11 | |||||||
Exon_number | 4-7/12 | |||||||
H15N14.1f.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 211-? | |||||||
CDS_position | 211-? | |||||||
Protein_position | 71-? | |||||||
Exon_number | 3/3 | |||||||
H15N14.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H15N14.1c.1:c.211_897+13del | |||||||
cDNA_position | 231-? | |||||||
CDS_position | 211-? | |||||||
Protein_position | 71-? | |||||||
Intron_number | 4-8/14 | |||||||
Exon_number | 4-8/15 | |||||||
H15N14.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H15N14.1e.1:c.211_690+13del | |||||||
cDNA_position | 231-? | |||||||
CDS_position | 211-? | |||||||
Protein_position | 71-? | |||||||
Intron_number | 4-7/13 | |||||||
Exon_number | 4-7/14 | |||||||
H15N14.1g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | 211-? | |||||||
CDS_position | 211-? | |||||||
Protein_position | 71-? | |||||||
Intron_number | 3-4/4 | |||||||
Exon_number | 3-5/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00056617 | ||||
Curator_confirmed | WBPerson11281 | |||||||
Phenotype_assay | Genotype | unc-22(RNAi) | Paper_evidence | WBPaper00056617 | ||||
Curator_confirmed | WBPerson11281 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. H. Sawa: Egl. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | HS | |||||||
WBPhenotype:0000697 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. H. Sawa: Pvul. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | HS | |||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00056617 | ||||||
Curator_confirmed | WBPerson11281 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00056617 | ||||||
Curator_confirmed | WBPerson11281 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00056617 | |||||||
Remark | 3992/3993-4959/4960 (967 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |