WormBase Tree Display for Variation: WBVar00249706

WBVar00249706 Name: Public_name: tm674
    Other_name: C04F1.3.1:c.250-109_484-22del
    HGVSg: CHROMOSOME_I:g.5719803_5721147del
  Sequence_details: SMap: S_parent: Sequence: C04F1
    Flanking_sequences: acgaaggatgcgagaccgtactaaaaatac gcatctaaaaatatattacagatcaaaaat
    Mapping_target: C04F1
    Source_location: 7 CHROMOSOME_I 5719802 5721148 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm674_external
      tm674_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 674
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002989
    Transcript: C04F1.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C04F1.3.1:c.250-109_484-22del
        Intron_number: 4-6/10
        Exon_number: 5-6/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
    Phenotype_not_observed: WBPhenotype:0000180 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in ventral cord motor neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
        EQ_annotations: Anatomy_term: WBbt:0005300 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson48
      WBPhenotype:0000880 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in ventral cord motor neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
        EQ_annotations: Anatomy_term: WBbt:0005300 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson48
  Remark: 8720/8721-10065/10066 (1354 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele