WormBase Tree Display for Variation: WBVar00249712

WBVar00249712 Name: Public_name: tm681
    Other_name: Y53C12A.1.1:c.861_1113+17del
    HGVSg: CHROMOSOME_II:g.9715214_9715483del
  Sequence_details: SMap: S_parent: Sequence: Y53C12A
    Flanking_sequences: gaaaccagtgattgtcaaaatccctcattc ctgaaaatgtctgatgatttcgtgggacgg
    Mapping_target: Y53C12A
    Source_location: 7 CHROMOSOME_II 9715213 9715484 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm681_external
      tm681_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 681
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006940
    Transcript: Y53C12A.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y53C12A.1.1:c.861_1113+17del
        cDNA_position: 866-?
        CDS_position: 861-?
        Protein_position: 287-?
        Intron_number: 4/8
        Exon_number: 4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000057 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. Golden: early larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 23328/23329-23598/23599 (270 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele