WormBase Tree Display for Variation: WBVar00249719

WBVar00249719 Name: Public_name: tm689
    Other_name: C07A12.4.2:c.1002_*20del
      C07A12.4.1:c.1002_*20del
    HGVSg: CHROMOSOME_X:g.4525674_4526224del
  Sequence_details: SMap: S_parent: Sequence: C07A12
    Flanking_sequences: gccagacttcgaagagatcaccaccgagaa caacgcatcggggttccatggacctgttgt
    Mapping_target: C07A12
    Source_location: 7 CHROMOSOME_X 4525673 4526225 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm689_external
      tm689_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00034929
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 689
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003963
    Transcript: C07A12.4.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C07A12.4.2:c.1002_*20del
        cDNA_position: 1054-1554
        CDS_position: 1002-?
        Protein_position: 334-?
        Intron_number: 4/6
        Exon_number: 4-6/7
      C07A12.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C07A12.4.1:c.1002_*20del
        cDNA_position: 1086-1586
        CDS_position: 1002-?
        Protein_position: 334-?
        Intron_number: 4/5
        Exon_number: 4-6/6
    Interactor: WBInteraction000052371
      WBInteraction000502945
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the NBP from Dr. P. Bazicalupo: could not obtain double with daf-7; Dr. A.P. Page: Dev. Biol. 308, 449 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11825/11826-12376/12377 (551 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele