WormBase Tree Display for Variation: WBVar00249720
expand all nodes | collapse all nodes | view schema
WBVar00249720 | Name | Public_name | tm690 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE30486:p.Lys441AlafsTer33 | |||||||
CE37743:p.Lys462AlafsTer33 | ||||||||
C06G4.2d.1:c.1320_1569del | ||||||||
CE37744:p.Lys416AlafsTer33 | ||||||||
C06G4.2a.1:c.1383_1632del | ||||||||
C06G4.2b.1:c.1245_1494del | ||||||||
C06G4.2c.1:c.*1225_*1474del | ||||||||
C06G4.2b.2:c.1245_1494del | ||||||||
C06G4.2a.2:c.1383_1632del | ||||||||
HGVSg | CHROMOSOME_III:g.7983968_7984591del | |||||||
Sequence_details | SMap | S_parent | Sequence | C06G4 | ||||
Flanking_sequences | ttcaagattgttcggatcatacgaggctct | tgcattcttcgaatccgtaatccatgggga | ||||||
Mapping_target | C06G4 | |||||||
Source_location | 7 | CHROMOSOME_III | 7983967 | 7984592 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm690_external | |||||||
tm690_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 690 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000542 | ||||||
Transcript | C06G4.2d.1 (11) | |||||||
C06G4.2a.2 (11) | ||||||||
C06G4.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C06G4.2c.1:c.*1225_*1474del | |||||||
cDNA_position | 1656-1905 | |||||||
Intron_number | 9/14 | |||||||
Exon_number | 9-10/15 | |||||||
C06G4.2b.2 (11) | ||||||||
C06G4.2a.1 (11) | ||||||||
C06G4.2b.1 (11) | ||||||||
Interactor | WBInteraction000571517 | |||||||
WBInteraction000571522 | ||||||||
WBInteraction000571564 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0002606 | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Likewise, loss of crt-1, cnx-1, itr-1, clp-1, tra-3, asp-3, or asp-4 partially suppressed HBx-induced cell killing (from 50% to 12-32% PLM death; Fig. 2A), indicating that HBx induces cell death in part through the necrotic pathway." | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000415 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Driscoll to the National Bioresource Project of Japan: No effect found on necrotic cell death. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041673 | |||||||
Remark | 7031/7032-7655/7656 (624 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |