WormBase Tree Display for Variation: WBVar00249745
expand all nodes | collapse all nodes | view schema
| WBVar00249745 | Name | Public_name | tm715 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | K03D10.1.1:c.349-155_1267delinsCCCCCC | ||||||
| HGVSg | CHROMOSOME_I:g.14130525_14132069delinsGGGGGG | ||||||
| Sequence_details | SMap | S_parent | Sequence | K03D10 | |||
| Flanking_sequences | CTTCAATCTTCAGCTCCTCACTTCCATGAG | TTAAAAACGTGCTGACGGCCCTTTTTTTCC | |||||
| Mapping_target | K03D10 | ||||||
| Type_of_mutation | Insertion | GGGGGGGG | |||||
| Deletion | |||||||
| PCR_product | tm715_external | ||||||
| tm715_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | FX | ||||||
| Author | Mitani S | ||||||
| DB_info | Database | National_Bioresource_Project | seq | 715 | |||
| NBP_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002181 | |||||
| Transcript | K03D10.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | K03D10.1.1:c.349-155_1267delinsCCCCCC | ||||||
| cDNA_position | ?-1270 | ||||||
| CDS_position | ?-1267 | ||||||
| Protein_position | ?-423 | ||||||
| Intron_number | 4-5/7 | ||||||
| Exon_number | 5-6/8 | ||||||
| Isolation | Mutagen | TMP/UV | |||||
| Genetics | Map | I | |||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| Laboratory_evidence | FX | ||||||
| Comment frm Dr. O Hobert to the National Bioresource Project of Japan: could not test axonal phenotype due to lethality. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| Laboratory_evidence | FX | ||||||
| Remark | 13730/13731-GGGGGGGG-15277/15278 (1557 bp deletion + 8 bp insertion) | ||||||
| This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 | Paper_evidence | WBPaper00041807 | |||||
| Method | NBP_knockout_allele |
